pSCAR_Cas9-blast_GFP
(Plasmid #162074)

• Purpose: 3rd generation lentivirus transfer vector for Cre-removable Cas9, GFP reporter, and blast resistance
• Depositing Lab: Robert Manguso
• Publication: Dubrot et al Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001.

Backbone

• Vector backbone: pLX311
• Backbone manufacturer: Broad Institute
• Backbone size w/o insert (bp): 8504
• Total vector size (bp): 13142
• Modifications to backbone: sv40-blasticidin cassette replaced with sv40-eGFP; insertion of Cas9-2a-blastR in EF1a Gateway cassette, insertion of loxP site in 3' LTR
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9-2a-blasticidin S deaminase
• Species: M. musculus (mouse), Synthetic; S. pyogenes Cas9
• Mutation: codon-optimized for expression in M. musculus
• Promoter: EF1a

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: EF-1a Forward (TCAAGCCTCAGACAGTGGTTC)
• 3′ sequencing primer: WPRE-R (CATAGCGTAAAAGGAGCAACA)

Gene/Insert 2

• Gene/Insert name: EGFP
• Species: Synthetic
• Promoter: sv40

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
• 3′ sequencing primer: EGFP-N (CGTCGCCGTCCAGCTCGACCAG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry