Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSCAR_Cas9-blast_GFP
(Plasmid #162074)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162074 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLX311
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 8504
  • Total vector size (bp) 13142
  • Modifications to backbone
    sv40-blasticidin cassette replaced with sv40-eGFP; insertion of Cas9-2a-blastR in EF1a Gateway cassette, insertion of loxP site in 3' LTR
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9-2a-blasticidin S deaminase
  • Species
    M. musculus (mouse), Synthetic; S. pyogenes Cas9
  • Mutation
    codon-optimized for expression in M. musculus
  • Promoter EF1a

Cloning Information for Gene/Insert 1

  • Cloning method Gateway Cloning
  • 5′ sequencing primer EF-1a Forward (TCAAGCCTCAGACAGTGGTTC)
  • 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Species
    Synthetic
  • Promoter sv40

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
  • 3′ sequencing primer EGFP-N (CGTCGCCGTCCAGCTCGACCAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCAR_Cas9-blast_GFP was a gift from Robert Manguso (Addgene plasmid # 162074 ; http://n2t.net/addgene:162074 ; RRID:Addgene_162074)
  • For your References section:

    In vivo screens using a selective CRISPR antigen removal lentiviral vector system reveal immune dependencies in renal cell carcinoma. Dubrot J, Lane-Reticker SK, Kessler EA, Ayer A, Mishra G, Wolfe CH, Zimmer MD, Du PP, Mahapatra A, Ockerman KM, Davis TGR, Kohnle IC, Pope HW, Allen PM, Olander KE, Iracheta-Vellve A, Doench JG, Haining WN, Yates KB, Manguso RT. Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001. 10.1016/j.immuni.2021.01.001 PubMed 33497609