pLX_EFS-Cre_ppt-del
(Plasmid #162073)

• Purpose: Compact Cre expression vector with modified PPT designed to generate high-titer non-integrating lentivirus when packaged with PsPax2-D64V (Addgene #63586)
• Depositing Lab: Robert Manguso
• Publication: Dubrot et al Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001.

Backbone

• Vector backbone: pLX311
• Backbone manufacturer: Broad Institute
• Backbone size w/o insert (bp): 8500
• Total vector size (bp): 7398
• Modifications to backbone: EF1a promoter replaced with shortened EFS promoter, deletion in U3-PPT (described in Kantor et al., 2011)
• Vector type: Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Cre
• Species: Synthetic
• Insert Size (bp): 1032
• Mutation: codon-optimized for expression in M. musculus
• Promoter: EFS (part of insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NsiI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: ggaattggtttaacataacaaattggctgtgg
• 3′ sequencing primer: WPRE-R (CATAGCGTAAAAGGAGCAACA);

Resource Information

• Supplemental Documents:
  • plx_efs-cre_predicted.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry