pSCAR_sgRNA_blast-tagBFP-lox2272
(Plasmid
#162071)
-
Purpose(Empty Backbone) 3rd generation lentivirus sgRNA delivery backbone with Cre-removable tagBFP reporter and blasticidin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRDA_118
-
Backbone manufacturerBroad Institute
- Backbone size (bp) 8332
-
Modifications to backboneEF1a-PuroR cassette replaced with synthesized EF1a-blastR-2a-tagBFP-lox2272 cassette using traditional restriction enzyme cloning with XmaI and MluI
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox, CRISPR
- Promoter U6, EF1a
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer GGAGGAGAAAATGAAAGCCATACGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCAR_sgRNA_blast-tagBFP-lox2272 was a gift from Robert Manguso (Addgene plasmid # 162071 ; http://n2t.net/addgene:162071 ; RRID:Addgene_162071) -
For your References section:
In vivo screens using a selective CRISPR antigen removal lentiviral vector system reveal immune dependencies in renal cell carcinoma. Dubrot J, Lane-Reticker SK, Kessler EA, Ayer A, Mishra G, Wolfe CH, Zimmer MD, Du PP, Mahapatra A, Ockerman KM, Davis TGR, Kohnle IC, Pope HW, Allen PM, Olander KE, Iracheta-Vellve A, Doench JG, Haining WN, Yates KB, Manguso RT. Immunity. 2021 Jan 20. pii: S1074-7613(21)00001-7. doi: 10.1016/j.immuni.2021.01.001. 10.1016/j.immuni.2021.01.001 PubMed 33497609