Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-B4E
(Plasmid #162067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162067 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET28a
  • Backbone size w/o insert (bp) 5207
  • Total vector size (bp) 6734
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Grow in BL21 for protein expression at 25ºC after induction with IPTG
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ampR-eIF4E fusion protein
  • Alt name
    B4E
  • Species
    Synthetic; E.coli
  • Insert Size (bp)
    1527
  • Mutation
    eIF4E incorporating the K119A mutation, which is known to increase the cap binding affinity of the protein
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtgatgtcggcgatatagg
  • 3′ sequencing primer gctagttattgctcagcgg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-B4E was a gift from Karen Polizzi (Addgene plasmid # 162067 ; http://n2t.net/addgene:162067 ; RRID:Addgene_162067)
  • For your References section:

    High resolution biosensor to test the capping level and integrity of mRNAs. Moya-Ramirez I, Bouton C, Kontoravdi C, Polizzi K. Nucleic Acids Res. 2020 Dec 16;48(22):e129. doi: 10.1093/nar/gkaa955. 10.1093/nar/gkaa955 PubMed 33152073
Commonly requested with: