pML104-natR412
(Plasmid
#162042)
-
PurposeExpresses Cas9 and contains natR412 guide which targets the natR gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepML104
- Backbone size w/o insert (bp) 11240
- Total vector size (bp) 11258
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenatR412 guide
-
SpeciesSynthetic
-
Insert Size (bp)33
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (destroyed during cloning)
- 3′ cloning site BclI (destroyed during cloning)
- 5′ sequencing primer T3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is derived from Addgene plasmid #67638 pML104 (deposited by John Wyrick) with an inserted guide sequence using the BclI-SwaII restriction sites.
Guide sequence: GTACCGCACCAGTGTCCCGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pML104-natR412 was a gift from Jolanda Van Leeuwen (Addgene plasmid # 162042 ; http://n2t.net/addgene:162042 ; RRID:Addgene_162042) -
For your References section:
Natural variants suppress mutations in hundreds of essential genes. Parts L, Batte A, Lopes M, Yuen MW, Laver M, San Luis BJ, Yue JX, Pons C, Eray E, Aloy P, Liti G, van Leeuwen J. Mol Syst Biol. 2021 May;17(5):e10138. doi: 10.15252/msb.202010138. 10.15252/msb.202010138 PubMed 34042294