pQE30-HypocratesCS
(Plasmid
#161957)
-
PurposeBacterial expression of inactivated control version of genetically encoded biosensor for (pseudo)hypohalous acids and their derivatives
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQE-30
- Backbone size w/o insert (bp) 3425
- Total vector size (bp) 4772
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHypocratesCS
-
SpeciesSynthetic
-
Insert Size (bp)1347
-
Mutationchanged cysteine 355 to serine
- Promoter T5
-
Tag
/ Fusion Protein
- 6xHIs tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCTTTGTGAGCGGATAACA
- 3′ sequencing primer CCGAGCGTTCTGAACAAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.02.22.432222 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE30-HypocratesCS was a gift from Dmitry Bilan (Addgene plasmid # 161957 ; http://n2t.net/addgene:161957 ; RRID:Addgene_161957) -
For your References section:
Hypocrates is a genetically encoded fluorescent biosensor for (pseudo)hypohalous acids and their derivatives. Kostyuk AI, Tossounian MA, Panova AS, Thauvin M, Raevskii RI, Ezerina D, Wahni K, Van Molle I, Sergeeva AD, Vertommen D, Gorokhovatsky AY, Baranov MS, Vriz S, Messens J, Bilan DS, Belousov VV. Nat Commun. 2022 Jan 10;13(1):171. doi: 10.1038/s41467-021-27796-2. 10.1038/s41467-021-27796-2 PubMed 35013284