IBMc050
(Plasmid
#161938)
-
PurposeCarries Golden Gate substitution insert for IBM with M86 intein. Plux2 as C-lobe promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufacturerBioBrick
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepSB1A3-BbsI-M86N-cat-Plux2-B32-M86C-SapI
-
SpeciesSynthetic
- Promoter Plux2
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer VF2 - TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer VR - ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
IBMc050 was a gift from Baojun Wang (Addgene plasmid # 161938 ; http://n2t.net/addgene:161938 ; RRID:Addgene_161938) -
For your References section:
A systematic approach to inserting split inteins for Boolean logic gate engineering and basal activity reduction. Ho TYH, Shao A, Lu Z, Savilahti H, Menolascina F, Wang L, Dalchau N, Wang B. Nat Commun. 2021 Apr 13;12(1):2200. doi: 10.1038/s41467-021-22404-9. 10.1038/s41467-021-22404-9 PubMed 33850130