pJT126 lenti pEF-rTetR(SE-G72P)-3XFLAG-LibCloneSite-T2A-mCherry-BSD-WPRE
(Plasmid #161926)

• Purpose: Lentiviral backbone for GoldenGate cloning effectors as a fusion with rTetR(SE-G72P)-3XFLAG
• Depositing Labs: Michael Bassik, Lacra Bintu
• Publication: Tycko et al Cell. 2020 Dec 9. pii: S0092-8674(20)31541-5. doi: 10.1016/j.cell.2020.11.024.

Backbone

• Vector backbone: pJT050
• Backbone size w/o insert (bp): 8932
• Total vector size (bp): 9001
• Modifications to backbone: replace rTetR with rTetR(SE-G72P)-3XFLAG
• Vector type: Mammalian Expression, Lentiviral, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rTetR(SE-G72P)
• Promoter: pEF
• Tag / Fusion Protein:
  • 3XFLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggatcttggttcattctcaagcctc

Resource Information

• Supplemental Documents:
  • pMCB820 pjt126-lenti-pef-rtetrse-g72p-3xflag-libclonesite-t2a-mcherry-bsd-wpre.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Backbone plasmid for cloning individual effectors or libraries of effector domains using GoldenGate cloning with BsmBI. rTetR(SE-G72P) is an engineered variant with reduced leakiness (Roney et al., 2016 PMC4914848).

Cloned with reagents shared by and in collaboration with Michael Bassik.