pBAD-mGreenLantern
(Plasmid #161913)

• Purpose: mGreenLantern fluorescent protein: bacterial expression plasmid
• Depositing Lab: Gregory Petsko
• Publication: Campbell et al Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18.

Backbone

• Vector backbone: pBAD/His-B
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3999
• Total vector size (bp): 4719
• Modifications to backbone: Backbone is identical to that of Addgene #37129 (several amino acids between the FP insert and His-tag are removed).
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mGreenLantern
• Alt name: mGL
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: araB
• Tag / Fusion Protein:
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: pBAD-F (ATGCCATAGCATTTTTATCCA)
• 3′ sequencing primer: pBAD-R (GATTTAATCTGTATCAGG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry