Skip to main content
Addgene

pEGFP-N1-HSD17B11-WT-FLAGC
(Plasmid #161903)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161903 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-N1-FLAGC
  • Backbone manufacturer
    Addgene #60360
  • Backbone size w/o insert (bp) 4718
  • Total vector size (bp) 5623
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hydroxysteroid 17-beta dehydrogenase 11
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    905
  • Entrez Gene
    HSD17B11 (a.k.a. 17-BETA-HSD11, 17-BETA-HSDXI, 17BHSD11, DHRS8, PAN1B, RETSDR2, SDR16C2)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer SEQ-CMV-F (GTAGGCGTGTACGGTGGGAGG)
  • 3′ sequencing primer SEQ-GFPN-R (CTCCTCGCCCTTGCTCACC)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Polymorphism rs6531985

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-HSD17B11-WT-FLAGC was a gift from Sébastien Britton (Addgene plasmid # 161903 ; http://n2t.net/addgene:161903 ; RRID:Addgene_161903)

  • For your References section:

    SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493
Related items:
Commonly requested with: