ampl43
(Plasmid
#161830)
-
Purpose(Empty Backbone) pRS416-dCas9-Mxi1+TetR+pRPR1(TetO)-NotI-gRNA plasmid marked with His, expressing dCas9-Mxi1 under Tef1 promoter, and a tet-inducible promoter for gRNA expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 161830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS416
-
Backbone manufacturerRonald Davis (Addgene Plasmid #73796)
-
Vector typeYeast Expression, CRISPR
- Promoter TEF1
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
- 3′ sequencing primer gtaatacgactcactataggg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ampl43 was a gift from Saeed Tavazoie (Addgene plasmid # 161830 ; http://n2t.net/addgene:161830 ; RRID:Addgene_161830) -
For your References section:
An inducible CRISPR interference library for genetic interrogation of Saccharomyces cerevisiae biology. Momen-Roknabadi A, Oikonomou P, Zegans M, Tavazoie S. Commun Biol. 2020 Nov 27;3(1):723. doi: 10.1038/s42003-020-01452-9. 10.1038/s42003-020-01452-9 PubMed 33247197