pLV.PGK.hLHX6
(Plasmid #161828)

• Purpose: Expresses human LHX6(LIM Homeobox 6) in mammalian cells
• Depositing Lab: Daniella Ottosson
• Publication: Giacomoni et al Cells. 2020 Nov 10;9(11). pii: cells9112451. doi: 10.3390/cells9112451.

Backbone

• Vector backbone: pLKO.1
• Backbone size w/o insert (bp): 7026
• Total vector size (bp): 8205
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human LHX6
• Species: H. sapiens (human)
• Insert Size (bp): 1179
• Mutation: AA 17-23 deletion
• GenBank ID: NM_014368.5
• Entrez Gene: LHX6 (a.k.a. LHX6.1)
• Promoter: PGK

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ggacagcgccagggagcaat
• 3′ sequencing primer: catagttaagaataccag

Resource Information

• Supplemental Documents:
  • pLV.PGK.humanLHX6.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the Addgene full sequence differs from the depositor's sequence.