Skip to main content
Addgene

lentiCRISPR v2-sgSLC7A11/xCT-1
(Plasmid #161818)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161818 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 12000
  • Total vector size (bp) 12000
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC7A11 solute carrier family 7 member 11 xCT
  • gRNA/shRNA sequence
    ATGAGCTTGATCGCAAGTTC
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_014331.4
  • Entrez Gene
    SLC7A11 (a.k.a. CCBR1, xCT)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgSLC7A11/xCT-1 was a gift from Boyi Gan (Addgene plasmid # 161818 ; http://n2t.net/addgene:161818 ; RRID:Addgene_161818)

  • For your References section:

    Cystine transporter regulation of pentose phosphate pathway dependency and disulfide stress exposes a targetable metabolic vulnerability in cancer. Liu X, Olszewski K, Zhang Y, Lim EW, Shi J, Zhang X, Zhang J, Lee H, Koppula P, Lei G, Zhuang L, You MJ, Fang B, Li W, Metallo CM, Poyurovsky MV, Gan B. Nat Cell Biol. 2020 Apr;22(4):476-486. doi: 10.1038/s41556-020-0496-x. Epub 2020 Mar 30. 10.1038/s41556-020-0496-x PubMed 32231310
Related items:
Commonly requested with: