Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lentiCRISPR v2-sgUpf1
(Plasmid #161810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161810 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Zhang lab
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting mouse Upf1
  • Alt name
    Pno
  • gRNA/shRNA sequence
    GGTAAGCATCCTCGTAACGC
  • Species
    M. musculus (mouse), Synthetic
  • GenBank ID
  • Entrez Gene
    Upf1 (a.k.a. B430202H16Rik, NORF1, PNO, PNORF-1, Ren, Rent1, Upflp)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPR v2-sgUpf1 was a gift from Yi Zhang (Addgene plasmid # 161810 ; http://n2t.net/addgene:161810 ; RRID:Addgene_161810)
  • For your References section:

    A transcriptional roadmap for 2C-like-to-pluripotent state transition. Fu X, Djekidel MN, Zhang Y. Sci Adv. 2020 May 29;6(22):eaay5181. doi: 10.1126/sciadv.aay5181. eCollection 2020 May. 10.1126/sciadv.aay5181 PubMed 32523982