lentiCRISPR v2-sgSmg7
(Plasmid
#161809)
-
Purposeguide RNA for Smg7
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161809 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerZhang lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting mouse Smg7
-
Alt nameSmg7
-
gRNA/shRNA sequenceTACTCAGGTATACATGACCG
-
SpeciesM. musculus (mouse), Synthetic
-
GenBank ID
-
Entrez GeneSmg7 (a.k.a. 9430023P16Rik, mKIAA0250)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiCRISPR v2-sgSmg7 was a gift from Yi Zhang (Addgene plasmid # 161809 ; http://n2t.net/addgene:161809 ; RRID:Addgene_161809) -
For your References section:
A transcriptional roadmap for 2C-like-to-pluripotent state transition. Fu X, Djekidel MN, Zhang Y. Sci Adv. 2020 May 29;6(22):eaay5181. doi: 10.1126/sciadv.aay5181. eCollection 2020 May. 10.1126/sciadv.aay5181 PubMed 32523982