pLenti-CamKIIa-monSTIM1
(Plasmid #161796)

• Purpose: Lentiviral vector expressing monSTIM1 in neurons.
• Depositing Lab: Won Do Heo
• Publication: Kim et al Nat Commun. 2020 Jan 10;11(1):210. doi: 10.1038/s41467-019-14005-4.

Backbone

• Vector backbone: pLenti-EF1a-hChR2(H134R)-EYFP-WPRE
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EGFP-CRY2PHR(mon)-STIM1
• Alt name: monSTIM1
• Species: H. sapiens (human)
• Insert Size (bp): 3702
• Entrez Gene: STIM1 (a.k.a. D11S4896E, GOK, IMD10, STRMK, TAM, TAM1)
• Promoter: CamKIIa
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: GAGGAGCTGTTCACCGGGG
• 3′ sequencing primer: aatccagaggttgattatcgataag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry