Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pABE8e-protein
(Plasmid #161788)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161788 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pD881-SR
  • Backbone manufacturer
    Atum
  • Backbone size w/o insert (bp) 2250
  • Total vector size (bp) 7095
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For expression of protein, grow in BL21 star bacteria. After reaching log phase at 37 degrees C, cold shock followed by induction with 0.8% rhamnose and growth at 18 degrees C overnight is recommended.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ABE8e base editor
  • Alt name
    ABE8e
  • Species
    Synthetic
  • Insert Size (bp)
    4845
  • Promoter pRhaBAD
  • Tags / Fusion Proteins
    • 8xHIS (N terminal on insert)
    • BPNLS (N terminal on insert)
    • BPNLS (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGAATTCAGGCGCTTTTTAG
  • 3′ sequencing primer AACGATCTCAAGAAGATCATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pABE8e-protein was a gift from David Liu (Addgene plasmid # 161788 ; http://n2t.net/addgene:161788 ; RRID:Addgene_161788)
  • For your References section:

    Precision genome editing using cytosine and adenine base editors in mammalian cells. Huang TP, Newby GA, Liu DR. Nat Protoc. 2021 Feb;16(2):1089-1128. doi: 10.1038/s41596-020-00450-9. Epub 2021 Jan 18. 10.1038/s41596-020-00450-9 PubMed 33462442