pABE8e-protein
(Plasmid #161788)

• Purpose: Rhamnose-inducible expression of 8xHIS-ABE8e in E. coli
• Depositing Lab: David Liu
• Publication: Huang et al Nat Protoc. 2021 Feb;16(2):1089-1128. doi: 10.1038/s41596-020-00450-9. Epub 2021 Jan 18.

Backbone

• Vector backbone: pD881-SR
• Backbone manufacturer: Atum
• Backbone size w/o insert (bp): 2250
• Total vector size (bp): 7095
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For expression of protein, grow in BL21 star bacteria. After reaching log phase at 37 degrees C, cold shock followed by induction with 0.8% rhamnose and growth at 18 degrees C overnight is recommended.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ABE8e base editor
• Alt name: ABE8e
• Species: Synthetic
• Insert Size (bp): 4845
• Promoter: pRhaBAD
• Tags / Fusion Proteins:
  • 8xHIS (N terminal on insert)
  • BPNLS (N terminal on insert)
  • BPNLS (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGAATTCAGGCGCTTTTTAG
• 3′ sequencing primer: AACGATCTCAAGAAGATCATC

Resource Information

• Supplemental Documents:
  • pABE8e-protein.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry