pMOD_C2911
(Plasmid
#161764)
-
PurposeMODULE C plasmid compatible with the Voytas Plant Genome Engineering Tool kit with an Agrobacterium promoter rolD expressing the TREX2 exonuclease.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMOD_C0000
-
Backbone manufacturerVoytas Plant Genome Engineering Tool kit
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 3670
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerolD:TREX2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
- Promoter rolD
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATAGGCGAAATTGGGTTCACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD_C2911 was a gift from Shaun Curtin (Addgene plasmid # 161764 ; http://n2t.net/addgene:161764 ; RRID:Addgene_161764) -
For your References section:
Alfalfa (Medicago sativa L.) pho2 mutant plants hyperaccumulate phosphate. Miller SS, Dornbusch MR, Farmer AD, Huertas R, Gutierrez-Gonzalez JJ, Young ND, Samac DA, Curtin SJ. G3 (Bethesda). 2022 May 30;12(6). pii: 6574359. doi: 10.1093/g3journal/jkac096. 10.1093/g3journal/jkac096 PubMed 35471600