pTRANS-Pho2-1/2-2-tRNA
(Plasmid #161762)

• Purpose: pTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)
• Depositing Lab: Shaun Curtin
• Publication: Miller et al G3 (Bethesda). 2022 May 30;12(6). pii: 6574359. doi: 10.1093/g3journal/jkac096.

Backbone

• Vector backbone: pTRANS_220
• Backbone manufacturer: Voytas Plant Genome Engineering Tool kit
• Backbone size w/o insert (bp): 9500
• Total vector size (bp): 17467
• Vector type: Plant Expression
• Selectable markers: neomycin phosphotransferase (kanR)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cas9 and gRNAs
• gRNA/shRNA sequence: MsPho2-1 and MsPho2-2
• Species: alflafa
• Promoter: CmYLCV Promoter

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CTAGAAGTAGTCAAGGCGGC

Resource Information

• Supplemental Documents:
  • pTRANS-Pho2-1_2-2-tRNA-Addgene #161762.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry