Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-hACE2-hygro
(Plasmid #161758)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 161758 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pLentiEGFPdestablized
  • Backbone size w/o insert (bp) 8770
  • Total vector size (bp) 11215
  • Modifications to backbone
    EGFP-PEST sequence was removed
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human ACE2
  • Alt name
    hACE2, ACE2
  • Species
    H. sapiens (human)
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter EF1a
  • Tag / Fusion Protein
    • P2A (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcacctcgattagttctcgag
  • 3′ sequencing primer caaggaggagaaaatgaaagcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hACE2-hygro was a gift from Neville Sanjana (Addgene plasmid # 161758 ; http://n2t.net/addgene:161758 ; RRID:Addgene_161758)
  • For your References section:

    Identification of Required Host Factors for SARS-CoV-2 Infection in Human Cells. Daniloski Z, Jordan TX, Wessels HH, Hoagland DA, Kasela S, Legut M, Maniatis S, Mimitou EP, Lu L, Geller E, Danziger O, Rosenberg BR, Phatnani H, Smibert P, Lappalainen T, tenOever BR, Sanjana NE. Cell. 2020 Oct 24. pii: S0092-8674(20)31394-5. doi: 10.1016/j.cell.2020.10.030. 10.1016/j.cell.2020.10.030 PubMed 33147445