pAAV-hSyn-miRFP-6xFLAG
(Plasmid
#161614)
-
PurposeCell morphology marker construct. Contains a near infrared fluorescent protein miRFP and six FLAG tags.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
-
How this works
- Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-hSyn
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4496
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiRFP-6xFLAG
-
Alt name3xFLAG-miRFP-3xFLAG
-
Alt namesmiRFP_FLAG
-
SpeciesSynthetic
-
Insert Size (bp)1131
-
MutationN/A
- Promoter Human synapsin 1 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCACGGGCGCGACCATCTGC
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The fluorescence of miRFP will be quenched after formaldehyde fixation. The pAAV-hSyn backbone contains WHP Posttranscriptional Response Element (WPRE) at 3'-UTR.
5' cloning site: EcoRI (not destroyed), 3' cloning site: HindIII (not destroyed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-miRFP-6xFLAG was a gift from Edward Boyden (Addgene plasmid # 161614 ; http://n2t.net/addgene:161614 ; RRID:Addgene_161614) -
For your References section:
Spatial Multiplexing of Fluorescent Reporters for Imaging Signaling Network Dynamics. Linghu C, Johnson SL, Valdes PA, Shemesh OA, Park WM, Park D, Piatkevich KD, Wassie AT, Liu Y, An B, Barnes SA, Celiker OT, Yao CC, Yu CJ, Wang R, Adamala KP, Bear MF, Keating AE, Boyden ES. Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035. 10.1016/j.cell.2020.10.035 PubMed 33232692