pHR_PGK-hACE2
(Plasmid
#161612)
-
PurposeExpression of human ACE2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR_PGK
- Backbone size w/o insert (bp) 9014
- Total vector size (bp) 11432
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAngiotensin-converting enzyme 2
-
Alt nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2418
-
GenBank IDNM_021804
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter PGK
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCAAAAGCGCACGTCTG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR_PGK-hACE2 was a gift from Brad Rosenberg (Addgene plasmid # 161612 ; http://n2t.net/addgene:161612 ; RRID:Addgene_161612) -
For your References section:
Identification of Required Host Factors for SARS-CoV-2 Infection in Human Cells. Daniloski Z, Jordan TX, Wessels HH, Hoagland DA, Kasela S, Legut M, Maniatis S, Mimitou EP, Lu L, Geller E, Danziger O, Rosenberg BR, Phatnani H, Smibert P, Lappalainen T, tenOever BR, Sanjana NE. Cell. 2020 Oct 24. pii: S0092-8674(20)31394-5. doi: 10.1016/j.cell.2020.10.030. 10.1016/j.cell.2020.10.030 PubMed 33147445