Skip to main content
Addgene

pCfB9342 (pgRNA_XIII-1_NatMX)
(Plasmid #161594)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161594 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pTAJAK-71 (pESC-NatMXsyn-USER)
  • Vector type
    Yeast Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    guiding RNA
  • gRNA/shRNA sequence
    GTCACAATTCGCAGACATAT
  • Species
    S. cerevisiae (budding yeast)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCfB9342 (pgRNA_XIII-1_NatMX) was a gift from Irina Borodina (Addgene plasmid # 161594 ; http://n2t.net/addgene:161594 ; RRID:Addgene_161594)

  • For your References section:

    Expansion of EasyClone-MarkerFree toolkit for Saccharomyces cerevisiae genome with new integration sites. Babaei M, Sartori L, Karpukhin A, Abashkin D, Matrosova E, Borodina I. FEMS Yeast Res. 2021 May 11;21(4). pii: 6249452. doi: 10.1093/femsyr/foab027. 10.1093/femsyr/foab027 PubMed 33893795
Included in kit:
Related items: