pJB005 CMV 3xFLAG-NLS-intC-ZF2
(Plasmid
#161550)
-
PurposeConstitutive expression of 3xFLAG-NLS-intC-ZF2 under the CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPD005 pcDNA Golden Gate
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xFLAG-NLS-intC-ZF2
-
SpeciesSynthetic
- Promoter CMV
-
Tag
/ Fusion Protein
- 3x-FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTGATGCGGTTTTGGCAGTACATCAATG
- 3′ sequencing primer CAGTGGGAGTGGCACCTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB005 CMV 3xFLAG-NLS-intC-ZF2 was a gift from Joshua Leonard (Addgene plasmid # 161550 ; http://n2t.net/addgene:161550 ; RRID:Addgene_161550) -
For your References section:
Model-guided design of mammalian genetic programs. Muldoon JJ, Kandula V, Hong M, Donahue PS, Boucher JD, Bagheri N, Leonard JN. Sci Adv. 2021 Feb 19;7(8). pii: 7/8/eabe9375. doi: 10.1126/sciadv.abe9375. Print 2021 Feb. 10.1126/sciadv.abe9375 PubMed 33608279