Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJM505 EF1α 3xFLAG-NLS-DsRed-Express2-ZF1 in TUPV2
(Plasmid #161535)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161535 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJM451 EF1α EBFP2-P2A-BlastR (TUPV2)
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3xFLAG-NLS-DsRed-Express2-ZF1
  • Species
    Synthetic
  • Promoter EF1α
  • Tag / Fusion Protein
    • 3x-FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCATTTCAGGTGTCGTGAGAGCTC
  • 3′ sequencing primer CAGTGGGAGTGGCACCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM505 EF1α 3xFLAG-NLS-DsRed-Express2-ZF1 in TUPV2 was a gift from Joshua Leonard (Addgene plasmid # 161535 ; http://n2t.net/addgene:161535 ; RRID:Addgene_161535)
  • For your References section:

    Model-guided design of mammalian genetic programs. Muldoon JJ, Kandula V, Hong M, Donahue PS, Boucher JD, Bagheri N, Leonard JN. Sci Adv. 2021 Feb 19;7(8). pii: 7/8/eabe9375. doi: 10.1126/sciadv.abe9375. Print 2021 Feb. 10.1126/sciadv.abe9375 PubMed 33608279