Skip to main content
Addgene

pJM585 ZF6x6-C mKate2 in TUPV1
(Plasmid #161529)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161529 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPD471 CMV MCS (TUPV1)
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKate2
  • Species
    Synthetic
  • Promoter ZF6x6-C

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGACACGGAAATGTTGAATAC
  • 3′ sequencing primer CAGTGGGAGTGGCACCTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM585 ZF6x6-C mKate2 in TUPV1 was a gift from Joshua Leonard (Addgene plasmid # 161529 ; http://n2t.net/addgene:161529 ; RRID:Addgene_161529)
  • For your References section:

    Model-guided design of mammalian genetic programs. Muldoon JJ, Kandula V, Hong M, Donahue PS, Boucher JD, Bagheri N, Leonard JN. Sci Adv. 2021 Feb 19;7(8). pii: 7/8/eabe9375. doi: 10.1126/sciadv.abe9375. Print 2021 Feb. 10.1126/sciadv.abe9375 PubMed 33608279