Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RIB VP64 R4
(Plasmid #161496)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161496 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene#98552 BB3rN_AD
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 10847
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Nourseothricin (clonNat), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dCAS9
  • Promoter pTEF2

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer gaggtatgtaggcggtgcta
  • 3′ sequencing primer GTACTGTGTCGTGAAGGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MS2-VP64
  • Promoter pPOR1

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCCTTCACGACACAGTAC
  • 3′ sequencing primer GACAGTGGAGGAAAATAATGTGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    gRNA (Targeting R4 in the RIB1 promoter)
  • Promoter pGAP

Cloning Information for Gene/Insert 3

  • Cloning method Unknown
  • 5′ sequencing primer GCACATTATTTTCCTCCACTGTC
  • 3′ sequencing primer ttatatttctctacaggggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RIB VP64 R4 was a gift from Brigitte Gasser & Diethard Mattanovich (Addgene plasmid # 161496 ; http://n2t.net/addgene:161496 ; RRID:Addgene_161496)
  • For your References section:

    Fine-Tuning of Transcription in Pichia pastoris Using dCas9 and RNA Scaffolds. Baumschabl M, Prielhofer R, Mattanovich D, Steiger MG. ACS Synth Biol. 2020 Dec 18;9(12):3202-3209. doi: 10.1021/acssynbio.0c00214. Epub 2020 Nov 12. 10.1021/acssynbio.0c00214 PubMed 33180466