T1ACR1_EYFP_pcDNA3.1
(Plasmid
#161027)
-
PurposeExpresses strongly red-shifted T1ACR1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 161027 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT1ACR1
-
SpeciesThraustochytrium sp.
-
Insert Size (bp)810
-
GenBank IDMT002470
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T1ACR1_EYFP_pcDNA3.1 was a gift from John Spudich (Addgene plasmid # 161027 ; http://n2t.net/addgene:161027 ; RRID:Addgene_161027) -
For your References section:
RubyACRs, nonalgal anion channelrhodopsins with highly red-shifted absorption. Govorunova EG, Sineshchekov OA, Li H, Wang Y, Brown LS, Spudich JL. Proc Natl Acad Sci U S A. 2020 Sep 15;117(37):22833-22840. doi: 10.1073/pnas.2005981117. Epub 2020 Sep 1. 10.1073/pnas.2005981117 PubMed 32873643