pLV_mTurquoise2-iLID-CAAX
(Plasmid #160999)

• Purpose: Mammalian expression of mTurquoise2-tagged iLID anchored to the plasma membrane via C-terminal fusion to CAAX motif from KRAS
• Depositing Lab: Sean R Collins
• Publication: Natwick et al ACS Synth Biol. 2021 May 21;10(5):1009-1023. doi: 10.1021/acssynbio.0c00511. Epub 2021 Apr 12.

Backbone

• Vector backbone: pLenti 2nd gen
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10479
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mTurquoise2-iLID-CAAX
• Species: Synthetic
• Insert Size (bp): 1239
• Promoter: EF1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggagtacgtcgtctttaggt
• 3′ sequencing primer: cgtcttttggcaatgtgagg

Resource Information

• Supplemental Documents:
  • pLV_UCOE_EF1a_mTurq2-iLID-CAAX_IRES_Blast.gb
• A portion of this plasmid was derived from a plasmid made by: The iLID-CAAX sequence was originally cloned by Dr. Brian Kuhlman's lab (Addgene plasmid #60411)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry