pMKO.1-shCdkn3
(Plasmid
#160955)
-
PurposeCdkn3 shRNA in pMKO.1 retroviral vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMKO.1 puro
-
Backbone manufacturerAddgene 8452
- Backbone size w/o insert (bp) 6340
- Total vector size (bp) 6369
-
Vector typeRetroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCdkn3 shRNA
-
gRNA/shRNA sequenceTRCN0000454139: CATAGACAGCCTTCGAGATGT
-
SpeciesM. musculus (mouse)
-
Entrez GeneCdkn3 (a.k.a. 2410006H10Rik, K, KAP)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer hU6
- 3′ sequencing primer pMKO.1 Rev: GCTTGTACTCGGTCATGGTAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMKO.1-shCdkn3 was a gift from Matthew Steinhauser (Addgene plasmid # 160955 ; http://n2t.net/addgene:160955 ; RRID:Addgene_160955) -
For your References section:
Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475