Skip to main content
Addgene

MSCV-HA-Nr4a1-Zf1
(Plasmid #160943)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160943 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMSCV-PIG
  • Backbone manufacturer
    Addgene 21654
  • Backbone size w/o insert (bp) 7656
  • Total vector size (bp) 9456
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nr4a1
  • Species
    M. musculus (mouse)
  • Mutation
    Deletion of Zinc finger 1 (C270 to C290)
  • Entrez Gene
    Nr4a1 (a.k.a. GFRP1, Gfrp, Hbr-1, Hbr1, Hmr, N10, NGFI-B, NGFIB, NP10, NUR77-1, NUR77-2, TIS1, TR3, nur77)
  • Promoter MSCV-LTR
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLXSN: cccttgaacctcctcgttcgacc
  • 3′ sequencing primer MSCV Rev: cagcggggctgctaaagcgcatgc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV-HA-Nr4a1-Zf1 was a gift from Matthew Steinhauser (Addgene plasmid # 160943 ; http://n2t.net/addgene:160943 ; RRID:Addgene_160943)

  • For your References section:

    Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. Zhang Y, Federation AJ, Kim S, O'Keefe JP, Lun M, Xiang D, Brown JD, Steinhauser ML. J Clin Invest. 2018 Nov 1;128(11):4898-4911. doi: 10.1172/JCI98353. Epub 2018 Oct 2. 10.1172/JCI98353 PubMed 30277475
Related items: