Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19_CRISPR_DpmrA
(Plasmid #160903)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160903 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 11298
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Streptococcus thermophilus
  • Promoter araBAD

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site sbf1 (not destroyed)
  • 3′ cloning site xba1 (not destroyed)
  • 5′ sequencing primer -
  • 3′ sequencing primer tctagattaagaaataatcttcatc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Lambda Red Recombineering Genes
  • Promoter araBAD

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site xba1 (not destroyed)
  • 3′ cloning site xba1 (not destroyed)
  • 5′ sequencing primer tctagattctactggtattggcaca
  • 3′ sequencing primer tctagacatgagcggatacatattt
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Zeocin Resistance Cassette

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site eco0109i (not destroyed)
  • 3′ cloning site eco0109i (not destroyed)
  • 5′ sequencing primer agGGCCTATTATTAACGCTTACAAT
  • 3′ sequencing primer aggccCTGTCTGACGCTCAGTGGAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid #62225: pCas
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

zeocin was cloned from the pCR2.1 topo gene from the invitrogen blunt topo plasmid

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19_CRISPR_DpmrA was a gift from Anne-Catrin Uhlemann (Addgene plasmid # 160903 ; http://n2t.net/addgene:160903 ; RRID:Addgene_160903)
  • For your References section:

    CrrB Positively Regulates High-Level Polymyxin Resistance and Virulence in Klebsiella pneumoniae. McConville TH, Annavajhala MK, Giddins MJ, Macesic N, Herrera CM, Rozenberg FD, Bhushan GL, Ahn D, Mancia F, Trent MS, Uhlemann AC. Cell Rep. 2020 Oct 27;33(4):108313. doi: 10.1016/j.celrep.2020.108313. 10.1016/j.celrep.2020.108313 PubMed 33113377