pMXS-IRES-Blast POLE1
(Plasmid
#160802)
-
PurposeExpress POLE1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXS-IRES-BLAST
- Backbone size w/o insert (bp) 5500
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePOLE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6861
-
MutationshPOLE_1 and shPOLE2 resistant
-
Entrez GenePOLE (a.k.a. CRCS12, FILS, IMAGEI, POLE1)
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer GGC GGA ATT TAC GTA GCG GCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-Blast POLE1 was a gift from Richard Possemato (Addgene plasmid # 160802 ; http://n2t.net/addgene:160802 ; RRID:Addgene_160802) -
For your References section:
Hyperactive CDK2 Activity in Basal-like Breast Cancer Imposes a Genome Integrity Liability that Can Be Exploited by Targeting DNA Polymerase epsilon. Sviderskiy VO, Blumenberg L, Gorodetsky E, Karakousi TR, Hirsh N, Alvarez SW, Terzi EM, Kaparos E, Whiten GC, Ssebyala S, Tonzi P, Mir H, Neel BG, Huang TT, Adams S, Ruggles KV, Possemato R. Mol Cell. 2020 Oct 28. pii: S1097-2765(20)30723-1. doi: 10.1016/j.molcel.2020.10.016. 10.1016/j.molcel.2020.10.016 PubMed 33152268