Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1P RTEL1_1
(Plasmid #160799)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160799 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1P
  • Backbone manufacturer
    The RNAi Consortium
  • Backbone size w/o insert (bp) 7466
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRTEL1_1
  • gRNA/shRNA sequence
    CCAACAGGAGTACATGACCAA
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCA TAT ACG ATA CAA GGC TGT TAG AG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1P RTEL1_1 was a gift from Richard Possemato (Addgene plasmid # 160799 ; http://n2t.net/addgene:160799 ; RRID:Addgene_160799)
  • For your References section:

    Hyperactive CDK2 Activity in Basal-like Breast Cancer Imposes a Genome Integrity Liability that Can Be Exploited by Targeting DNA Polymerase epsilon. Sviderskiy VO, Blumenberg L, Gorodetsky E, Karakousi TR, Hirsh N, Alvarez SW, Terzi EM, Kaparos E, Whiten GC, Ssebyala S, Tonzi P, Mir H, Neel BG, Huang TT, Adams S, Ruggles KV, Possemato R. Mol Cell. 2020 Oct 28. pii: S1097-2765(20)30723-1. doi: 10.1016/j.molcel.2020.10.016. 10.1016/j.molcel.2020.10.016 PubMed 33152268