-
PurposeMini-transposon donor plasmid for V. cholerae CAST system. pUC19 vector backbone.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 160732 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVchCAST donor DNA (Mini-Tn)
-
SpeciesV. cholerae
- Promoter N/A
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTTACGGTTCCTGGCC
- 3′ sequencing primer CTTCGCTATTACGCCAGCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Previously referred to as INTEGRATE.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSL1119 (pDonor) was a gift from Samuel H. Sternberg (Addgene plasmid # 160732 ; http://n2t.net/addgene:160732 ; RRID:Addgene_160732) -
For your References section:
CRISPR RNA-guided integrases for high-efficiency, multiplexed bacterial genome engineering. Vo PLH, Ronda C, Klompe SE, Chen EE, Acree C, Wang HH, Sternberg SH. Nat Biotechnol. 2020 Nov 23. pii: 10.1038/s41587-020-00745-y. doi: 10.1038/s41587-020-00745-y. 10.1038/s41587-020-00745-y PubMed 33230293
