pAAV-UBC-S2-RAB_EKARev
(Plasmid #160726)

• Purpose: Signaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains RFP-based fluorescent reporter RAB-EKARev (ERK indicator), VSV-G tag, and S2 protein scaffold.
• Depositing Lab: Edward Boyden
• Publication: Linghu et al Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035.

Backbone

• Vector backbone: pAAV-UBC
• Backbone manufacturer: Epoch Life Science
• Backbone size w/o insert (bp): 4178
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S2-RAB_EKARev
• Alt name: S2-RAB_EKARev-VSVg
• Alt name: SiRI-S2-RAB_EKARev
• Species: Synthetic
• Insert Size (bp): 3273
• Mutation: N/A
• GenBank ID: MT449932
• Promoter: Human ubiquitin C (UBC) promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATCGCTGTGATCGTCACTTGG
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • pAAV-UBC-S2-RAB_EKARev.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pAAV-UBC backbone contains WHP Post-transcriptional Response Element (WPRE) at 3'-UTR. The RAB_EKARev segment in this gene contains protein sequences that are similar to HA tag, and antibodies against HA tag may bind to this protein. 5' cloning site: SpeI (not destroyed), 3' cloning site: HindIII (not destroyed).