pAAV-UBC-S3-ExRaiAKAR
(Plasmid #160724)

• Purpose: Signaling reporter island (SiRI) construct for spatially multiplexed imaging. Contains GFP-based fluorescent reporter ExRai-AKAR (PKA indicator), V5 tag, and S3 protein scaffold.
• Depositing Lab: Edward Boyden
• Publication: Linghu et al Cell. 2020 Nov 17. pii: S0092-8674(20)31399-4. doi: 10.1016/j.cell.2020.10.035.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-UBC
• Backbone manufacturer: Epoch Life Science
• Backbone size w/o insert (bp): 4178
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: S3-ExRaiAKAR
• Alt name: S3-ExRaiAKAR-V5
• Alt name: SiRI-S3-ExRaiAKAR
• Species: Synthetic
• Insert Size (bp): 3114
• Mutation: N/A
• GenBank ID: MT449930
• Promoter: Human ubiquitin C (UBC) promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATCGCTGTGATCGTCACTTGG
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • pAAV-UBC-S3-ExRaiAKAR.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pAAV-UBC backbone contains WHP Post-transcriptional Response Element (WPRE) at 3'-UTR. 5' cloning site: SpeI (not destroyed), 3' cloning site: HindIII (not destroyed).