MDH1-PGK-GFP microRNA-10b
(Plasmid #16070)

• Depositing Lab: Bob Weinberg
• Publication: Ma et al Nature. 2007 Oct 11. 449(7163):682-8.

Backbone

• Vector backbone: MDH1-PGK-GFP 2.0
• Backbone size w/o insert (bp): 6963
• Vector type: Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: microRNA-10b
• Alt name: miR-10b
• Species: H. sapiens (human)
• Insert Size (bp): 315
• Entrez Gene: MIR10B (a.k.a. MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: EGFP-C
• 3′ sequencing primer: ggatcccaatatttgcatgtcgc

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.