10TALE_Pmin_fLuc
(Plasmid
#160663)
-
PurposeExpression of the firefly luciferase reporter upon binding of a transcriptional activator to target sites. The plasmid contains 10 copies of target sites for the TALEN1257 DNA-binding domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.16
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name10TALE_Pmin_fLuc
-
SpeciesSynthetic
- Promoter minimal
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGTGAATCGATAGTACTAACATAC
- 3′ sequencing primer cactgcattctagttgtggtttgtcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGaber, R., Lebar, T., Majerle, A. et al. Designable DNA-binding domains enable construction of logic circuits in mammalian cells. Nat Chem Biol 10, 203–208 (2014). https://doi.org/10.1038/nchembio.1433
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
10TALE_Pmin_fLuc was a gift from Roman Jerala (Addgene plasmid # 160663 ; http://n2t.net/addgene:160663 ; RRID:Addgene_160663) -
For your References section:
Engineering and Rewiring of a Calcium-Dependent Signaling Pathway. Mesko M, Lebar T, Dekleva P, Jerala R, Bencina M. ACS Synth Biol. 2020 Aug 21;9(8):2055-2065. doi: 10.1021/acssynbio.0c00133. Epub 2020 Jul 20. 10.1021/acssynbio.0c00133 PubMed 32643923