Skip to main content
Addgene

pGS_128
(Plasmid #160651)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160651 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNH605
  • Backbone size w/o insert (bp) 7913
  • Total vector size (bp) 8970
  • Modifications to backbone
    GAL1 promoter replaced with pZ estradiol-inducible promoter
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Apolipoprotein E e3
  • Alt name
    APOE3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1023
  • Mutation
    e3 allele
  • Entrez Gene
    APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
  • Promoter pZ estradiol inducible promoter
  • Tag / Fusion Protein
    • Kar2 signal sequence

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AATATACCTCTATACTTTAACGTC
  • 3′ sequencing primer atttagctatttgcttagagctcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGS_128 was a gift from Susan Lindquist & Li-Huei Tsai (Addgene plasmid # 160651 ; http://n2t.net/addgene:160651 ; RRID:Addgene_160651)
  • For your References section:

    APOE4 disrupts intracellular lipid homeostasis in human iPSC-derived glia. Sienski G, Narayan P, Bonner JM, Kory N, Boland S, Arczewska AA, Ralvenius WT, Akay L, Lockshin E, He L, Milo B, Graziosi A, Baru V, Lewis CA, Kellis M, Sabatini DM, Tsai LH, Lindquist S. Sci Transl Med. 2021 Mar 3;13(583). pii: 13/583/eaaz4564. doi: 10.1126/scitranslmed.aaz4564. 10.1126/scitranslmed.aaz4564 PubMed 33658354