pGS_128
(Plasmid #160651)

• Purpose: Expresses Human APOE3 with a yeast secretory signal peptide under the control of a beta-estradiol inducible promoter
• Depositing Labs: Susan Lindquist, Li-Huei Tsai
• Publication: Sienski et al Sci Transl Med. 2021 Mar 3;13(583). pii: 13/583/eaaz4564. doi: 10.1126/scitranslmed.aaz4564.

Backbone

• Vector backbone: pNH605
• Backbone size w/o insert (bp): 7913
• Total vector size (bp): 8970
• Modifications to backbone: GAL1 promoter replaced with pZ estradiol-inducible promoter
• Vector type: Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Apolipoprotein E e3
• Alt name: APOE3
• Species: H. sapiens (human)
• Insert Size (bp): 1023
• Mutation: e3 allele
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
• Promoter: pZ estradiol inducible promoter
• Tag / Fusion Protein:
  • Kar2 signal sequence

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AATATACCTCTATACTTTAACGTC
• 3′ sequencing primer: atttagctatttgcttagagctcc

Resource Information

• Supplemental Documents:
  • pGS128_pNH605-pZ-5UTR-Kar2-hApoE3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry