pGS_107
(Plasmid #160650)

• Purpose: Expresses Human APOE4 with a yeast secretory signal peptide under the control of the yeast Gal promoter
• Depositing Labs: Susan Lindquist, Li-Huei Tsai
• Publication: Sienski et al Sci Transl Med. 2021 Mar 3;13(583). pii: 13/583/eaaz4564. doi: 10.1126/scitranslmed.aaz4564.

Backbone

• Vector backbone: pNH606
• Backbone size w/o insert (bp): 6775
• Total vector size (bp): 7835
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Apolipoprotein E e4
• Alt name: APOE4
• Species: H. sapiens (human)
• Insert Size (bp): 1026
• Mutation: e4 allele
• Entrez Gene: APOE (a.k.a. AD2, APO-E, ApoE4, LDLCQ5, LPG)
• Promoter: GAL1
• Tag / Fusion Protein:
  • Kar2 signal sequence (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aatatacctctatactttaacgtc

Resource Information

• Supplemental Documents:
  • pgs107_pnh606-pz-5utr-kar2-hapoe4.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry