pDGB3 omega1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1657)
(Plasmid
#160640)
-
PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB3_omega1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTnos:NptII:Pnos-SF-P35s:hCas9:tNos
-
SpeciesUnspecified
-
Insert Size (bp)7085
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos, 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 omega1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1657) was a gift from Diego Orzaez (Addgene plasmid # 160640 ; http://n2t.net/addgene:160640 ; RRID:Addgene_160640)