Skip to main content
Addgene

pDGB3_alpha1 P35S:SV40-AcrIIA4_CONb:Tnos (GB3344)
(Plasmid #160635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDGB3_alpha1
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AcrIIA4
  • Species
    Synthetic
  • Insert Size (bp)
    1810
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter 35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3_alpha1 P35S:SV40-AcrIIA4_CONb:Tnos (GB3344) was a gift from Diego Orzaez (Addgene plasmid # 160635 ; http://n2t.net/addgene:160635 ; RRID:Addgene_160635)
  • For your References section:

    Strong and tunable anti-CRISPR/Cas activities in plants. Calvache C, Vazquez-Vilar M, Selma S, Uranga M, Fernandez-Del-Carmen A, Daros JA, Orzaez D. Plant Biotechnol J. 2022 Feb;20(2):399-408. doi: 10.1111/pbi.13723. Epub 2021 Oct 31. 10.1111/pbi.13723 PubMed 34632687