pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
(Plasmid
#160624)
-
PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain VPR (VP64+p65+Rta)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB3_alpha1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP35S:MS2:VPR:Tnos
-
SpeciesUnspecified
-
Insert Size (bp)3149
-
MutationBsaI and BsmBI sites removed
- Promoter P35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830) was a gift from Diego Orzaez (Addgene plasmid # 160624 ; http://n2t.net/addgene:160624 ; RRID:Addgene_160624) -
For your References section:
Strong gene activation in plants with genome-wide specificity using a new orthogonal CRISPR/Cas9-based programmable transcriptional activator. Selma S, Bernabe-Orts JM, Vazquez-Vilar M, Diego-Martin B, Ajenjo M, Garcia-Carpintero V, Granell A, Orzaez D. Plant Biotechnol J. 2019 Sep;17(9):1703-1705. doi: 10.1111/pbi.13138. Epub 2019 May 23. 10.1111/pbi.13138 PubMed 31034138