Skip to main content
Addgene

pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830)
(Plasmid #160624)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160624 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDGB3_alpha1
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P35S:MS2:VPR:Tnos
  • Species
    Unspecified
  • Insert Size (bp)
    3149
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter P35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmBI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3 alpha2 P35S:MS2:VPR:Tnos (GB1830) was a gift from Diego Orzaez (Addgene plasmid # 160624 ; http://n2t.net/addgene:160624 ; RRID:Addgene_160624)
  • For your References section:

    Strong gene activation in plants with genome-wide specificity using a new orthogonal CRISPR/Cas9-based programmable transcriptional activator. Selma S, Bernabe-Orts JM, Vazquez-Vilar M, Diego-Martin B, Ajenjo M, Garcia-Carpintero V, Granell A, Orzaez D. Plant Biotechnol J. 2019 Sep;17(9):1703-1705. doi: 10.1111/pbi.13138. Epub 2019 May 23. 10.1111/pbi.13138 PubMed 31034138