Skip to main content
Addgene

pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724)
(Plasmid #160621)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160621 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDGB3_alpha1
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    U6-26:gRNA 4 (pNos): 2.1 aptamer
  • gRNA/shRNA sequence
    372
  • Species
    Synthetic
  • Insert Size (bp)
    2627
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter U6-26

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGTGGCAGGATATATTGTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmBI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDGB3 alpha1 U6-26:gRNA 4 (Pnos):2.1 aptamer (GB1724) was a gift from Diego Orzaez (Addgene plasmid # 160621 ; http://n2t.net/addgene:160621 ; RRID:Addgene_160621)

  • For your References section:

    Strong gene activation in plants with genome-wide specificity using a new orthogonal CRISPR/Cas9-based programmable transcriptional activator. Selma S, Bernabe-Orts JM, Vazquez-Vilar M, Diego-Martin B, Ajenjo M, Garcia-Carpintero V, Granell A, Orzaez D. Plant Biotechnol J. 2019 Sep;17(9):1703-1705. doi: 10.1111/pbi.13138. Epub 2019 May 23. 10.1111/pbi.13138 PubMed 31034138
Related items:
Commonly requested with: