Skip to main content
Addgene

pEGB3 alpha1 Pnos:PhiC31int:Tnos (GB1531)
(Plasmid #160616)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160616 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGB3_alpha1
  • Backbone manufacturer
    self-made; derived from pCambia1302 generated at the Cambia Institute
  • Vector type
    Plant Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhiC31
  • Species
    Synthetic
  • Insert Size (bp)
    2627
  • Mutation
    BsaI and BsmBI sites removed
  • Promoter Pnos

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer caacctctcgggcttctgga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmBI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGB3 alpha1 Pnos:PhiC31int:Tnos (GB1531) was a gift from Diego Orzaez (Addgene plasmid # 160616 ; http://n2t.net/addgene:160616 ; RRID:Addgene_160616)
  • For your References section:

    A memory switch for plant synthetic biology based on the phage varphiC31 integration system. Bernabe-Orts JM, Quijano-Rubio A, Vazquez-Vilar M, Mancheno-Bonillo J, Moles-Casas V, Selma S, Gianoglio S, Granell A, Orzaez D. Nucleic Acids Res. 2020 Apr 6;48(6):3379-3394. doi: 10.1093/nar/gkaa104. 10.1093/nar/gkaa104 PubMed 32083668