pEGB3 alpha2 P35S:RDF:T35S (GB1508)
(Plasmid
#160613)
-
PurposeTU for the constitutive expression of Streptomyces phage PhiC31-encoded recombination directionality factor (RDF) (PhiC31 gp3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB3_alpha2
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRDF
-
SpeciesSynthetic
-
Insert Size (bp)1993
-
MutationBsaI and BsmBI sites removed
- Promoter 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB3 alpha2 P35S:RDF:T35S (GB1508) was a gift from Diego Orzaez (Addgene plasmid # 160613 ; http://n2t.net/addgene:160613 ; RRID:Addgene_160613) -
For your References section:
A memory switch for plant synthetic biology based on the phage varphiC31 integration system. Bernabe-Orts JM, Quijano-Rubio A, Vazquez-Vilar M, Mancheno-Bonillo J, Moles-Casas V, Selma S, Gianoglio S, Granell A, Orzaez D. Nucleic Acids Res. 2020 Apr 6;48(6):3379-3394. doi: 10.1093/nar/gkaa104. 10.1093/nar/gkaa104 PubMed 32083668