pDGB3 alpha2 P35S:dCas9:SRDX:Tnos (GB1188)
(Plasmid
#160608)
-
PurposeTU for the expression of the dCas9 with the repressor domain SRDX as a CT fusion (CRISPR tools)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 160608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDGB3_alpha2
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP35s:dCas9:SRDX:tNOS
-
SpeciesSynthetic
-
Insert Size (bp)5732
-
MutationBsaI and BsmBI sites removed
- Promoter P35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3 alpha2 P35S:dCas9:SRDX:Tnos (GB1188) was a gift from Diego Orzaez (Addgene plasmid # 160608 ; http://n2t.net/addgene:160608 ; RRID:Addgene_160608) -
For your References section:
A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579