pEGB3 alpha1 35s:PIF6:tNos (GB0170)
(Plasmid #160606)

• Purpose: TU for the constitutive expression of a chimeric construct comprising a DNA binding protein fused to A. thaliana PIF6 (amino acids 1-100) and a nuclear localization sequence. Part of a red light-controlled synthetic genetic switch
• Depositing Lab: Diego Orzaez
• Publication: Calvache et al Plant Biotechnol J. 2022 Feb;20(2):399-408. doi: 10.1111/pbi.13723. Epub 2021 Oct 31.

Backbone

• Vector backbone: pDGB3_alpha1
• Backbone manufacturer: self-made; derived from pCambia1302 generated at the Cambia Institute
• Vector type: Plant Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PIF6
• Species: Synthetic
• Insert Size (bp): 2487
• Mutation: BsaI and BsmBI sites removed
• Promoter: P35S

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: GGTGGCAGGATATATTGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsmBI