Skip to main content
Addgene

pUPD2 AtU6-26:AsCas12a_DR (GB1442)
(Plasmid #160574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 160574 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUPD2
  • Backbone manufacturer
    self-made; derived from the BioBrick assembly plasmid pSB1C3
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtU6-26:AsCas12a_DR
  • Species
    Synthetic
  • Insert Size (bp)
    76
  • Mutation
    BsaI and BsmBI sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer gctttcgctaaggatgatttctgg
  • 3′ sequencing primer cagggtggtgacaccttgcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Compatible with GoldenBraid; insert can be released with BsaI

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUPD2 AtU6-26:AsCas12a_DR (GB1442) was a gift from Diego Orzaez (Addgene plasmid # 160574 ; http://n2t.net/addgene:160574 ; RRID:Addgene_160574)
  • For your References section:

    Assessment of Cas12a-mediated gene editing efficiency in plants. Bernabe-Orts JM, Casas-Rodrigo I, Minguet EG, Landolfi V, Garcia-Carpintero V, Gianoglio S, Vazquez-Vilar M, Granell A, Orzaez D. Plant Biotechnol J. 2019 Apr 5. doi: 10.1111/pbi.13113. 10.1111/pbi.13113 PubMed 30950179